Q: What are TissueScan oncology panels?

A: TissueScan are panels of pre-normalized cDNA from multiple (48 for most of the panels) cancer tissues.  The tissue samples used for each type of TissueScan panel cover all disease stages and are accompanied by comprehensive pathology reports.  By designing a pair of gene-specific or SNP specific primers, scientists can study the following via a single real-time PCR reaction

• Expression profile changes during disease progression for a particular transcript
• SNP profiling throughout disease progression
• Validation of biomarker candidates obtained from microarray data
• Relevance of a potential tumor suppressor/oncogene across different cancer types

Q: Currently how many cancer types are available for TissueScan?

A:

• Colon Cancer Disease Panels
• Lung Cancer Disease Panels
• Ovarian Cancer Disease Panels
• Thyroid Cancer Disease Panels
• Prostate Cancer Disease Panels

Q: Was tissue used to generate this cDNA flash frozen to preserve RNA integrity?

A: All of the frozen tissues were snap frozen upon biopsy.  The majority were frozen within 30 minutes and many within 15 to 20 minutes.
All of the RNA is examined before cDNA synthesis and shows minimal to no degradation by Agilent Bioanalyzer analysis (results are shown in each pathology report).

Q: Were tissues micro-dissected to separate tumor cells from non-tumor cells?

A: No, the tissue was not micro-dissected to separate tumor from non-tumor cells.  Samples were selected based on tumor content
(minimally 50% tumor) as determined by microscopic pathology analysis. Such information is available for each sample in the pathology report.

Q: Were any preservatives or embedding agents used?

A: The tissue samples are frozen in OCT, which serves as an excellent protectant against the effects of long term –80C storage.  Before processing the tissue for RNA isolation, most of the frozen OCT is dissected away prior to homogenization.  Also, reagents and protocols for RNA isolation have been optimized to overcome residual OCT interference.

Q: Why is there a listing of a tumor grade for "normal" tissues?

A: The “normal” tissues are taken from patients diagnosed with a tumor, but the tissues harvested were from normal regions.

Q: Were the normal samples taken from the same donors of any of the disease samples, or were all samples taken from different donors?

A: Some of the normal samples were taken from patients from whom other tissue samples (disease stages I-IV) were taken.  These paired samples can be identified by the identical pathology report numbers listed for different wells.

Q: How was the cDNA prepared?

A: Beginning with high quality total RNA from Cytomyx, 1^st strand cDNA was generated using an oligo-dT primer.  Cytomyx provides an in-depth pathology report (including histology sections) for all of the RNA used in these panels, which can be viewed on the Cytomyx website.

Q: How much cDNA is deposited in each well?  What is the amount of cDNA per well in terms of corresponding total RNA or mRNA?

A: Well to well amounts of cDNA may vary due to normalization based on beta-actin. The average amount of cDNA is 2-3 ng per well, corresponding to 2-3ng of mRNA.

Q: What genes were used to validate these panels?

Q: What does the 48 well plate format look like?  Is it 8x6 wells or 12x4 wells?

A: The plate is in a 12x4 array, similar to an upper half of a 96 well plate. When placing the assembled panel into a PCR machine, we recommend placing it in the middle of the heat block to avoid uneven heating at the periphery.

Q: We need an actin TaqMan probe that will detect the product of your actin primers labeled with HEX and also a multiplex PCR buffer. Could you please advise on which suppliers you would recommend for use with your product?

A: We frequently use Applied Biosystems (http://www.appliedbiosystems.com ) as our source of real-time PCR reagents (buffers, etc.), and order primers from MWG Biotech (http://www.mwg-biotech.com/html/all/index.php) or BBL (http://www.bioserve.com/index.cfm ), both of whom offered HEX-labeled primers.

Q: What actin primers were used for normalization of your tissues and what is the target sequence?

A: The actin sequence used to design the primers was NCBI accession # NM_001101, for Homo sapiens actin, beta (ACTB), mRNA. 
The primer sequences and targeted actin sequences are as follows:

forward primer:  CAGCCATGTACGTTGCTATCCAGG

reverse primer:  AGGTCCAGACGCAGGATGGCATG

targeted beta-actin sequence:

CAGCCATGTACGTTGCTATCCAGGCTGTGCTATCCCTGTACGCCTCTGGCCGTACCACTGGCATCGTGATGGACTCCGGTGACGGGGTCACCCA
CACTGTGCCCATCTACGAGGGGTATGCCCTCCCCCATGCCATCCTGCGTCTGGACCT

Q: In the Application Guide you give the pipetting scheme for Taqman, and it lists a 20x Taqman probe.  What should the final concentration of the probe be?

A: Each Taqman probe may have its optimal working concentration. You can determine it by doing some pilot experiments. However according to Applied Biosystems protocol, a 1x or 250 nM final concentration usually gives good results.

Q: In the Application Guide you indicate the thermocylers that are suitable for use with your product (ABI Prism 7000, 7700, 7300, 7500, 9500).  We have access to another model thermocycler.  Is this model compatible with your product plates?

A: The PCR plates used for the product are from ABgene (AB-0600) and they are not compatible with every model. The best solution is to find a machine that is listed to be compatible with these plates.  Another solution is to re-suspend the cDNA in the provided plate and transfer it to a plate compatible with your machine. To do so, add half of the reaction volume to each well of the product plate and incubate on ice for 20 minutes. Then transfer the resuspended solution to a plate using a multi-channel pipette, add the remainder of the reaction volume and other reagents, and run your experiment.  Exceptionally careful resuspension and pipetting would be mandatory to preserve the quantitative nature of this product.